After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD81 Информация о продукте «Клон cDNA»
Размер кДНК:711bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd81 molecule with C terminal HA tag.
Синоним гена:Tapa1, Cd81
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80331-ACGRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80331-ACRRBS15400
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80331-CFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80331-CHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80331-CMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80331-CYRBS13340
Крыса CD81/TAPA1 Джин клон кДНК в вектор клонированияRG80331-GRBS5130
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80331-NFRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80331-NHRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80331-NMRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80331-NYRBS13340
Крыса CD81/TAPA1 Джин ORF экспрессии кДНК клона плазмидыRG80331-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD81, also known as TAPA-1, belongs to the transmembrane 4 superfamily, also known as the tetraspanin family. Members of this family mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility.CD81 is a widely expressed cell-surface protein involved in an astonishing variety of biologic responses. It is related to adhesion, morphology, activation, proliferation, and differentiation of B, T, and other cells. On B cells CD81 is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging Ag specific recognition and CD21-mediated complement recognition.

  • Petracca R. et al., 2000, J Virol. 74 (10): 4824-30.
  • Bartosch B. et al., 2003, The Journal of Biological Chemistry. 278 (43): 41624-30.
  • Clark KL. et al., 2001, Journal of Immunology. 167 (9): 5115-21.
  • Size / Price
    Каталог: RG80331-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.