Быстрый заказ

Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD70 Информация о продукте «Клон cDNA»
Размер кДНК:588bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd70 molecule with N terminal Flag tag.
Синоним гена:Cd70
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80161-ACGRBS15400
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80161-ACRRBS15400
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80161-CFRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80161-CHRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80161-CMRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80161-CYRBS13340
Крыса CD70/CD27L/TNFSF7 Джин клон кДНК в вектор клонированияRG80161-GRBS5130
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80161-NFRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80161-NHRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80161-NMRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80161-NYRBS13340
Крыса CD70/CD27L/TNFSF7 Джин ORF экспрессии кДНК клона плазмидыRG80161-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.

  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.
  • Size / Price
    Каталог: RG80161-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.