Быстрый заказ

Text Size:AAA

Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD68 Информация о продукте «Клон cDNA»
Размер кДНК:993bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd68 molecule with N terminal His tag.
Синоним гена:MGC114377, Cd68
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80307-ACGRBS15400
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80307-ACRRBS15400
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80307-CFRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80307-CHRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80307-CMRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80307-CYRBS13340
Крыса CD68 Джин клон кДНК в вектор клонированияRG80307-GRBS5130
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80307-NFRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80307-NHRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80307-NMRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80307-NYRBS13340
Крыса CD68 Джин ORF экспрессии кДНК клона плазмидыRG80307-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Каталог: RG80307-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.