Быстрый заказ

Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CD68 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001031638.1
    Размер кДНК:993bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd68 molecule with N terminal His tag.
    Синоним гена:MGC114377, Cd68
    Виды:Rat
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD68 qPCR primers for gene expression analysis, RP300283 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80307-ACGRBS15400
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80307-ACRRBS15400
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80307-CFRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80307-CHRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80307-CMRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80307-CYRBS13340
    Крыса CD68 Джин клон кДНК в вектор клонированияRG80307-GRBS5130
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80307-NFRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80307-NHRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80307-NMRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80307-NYRBS13340
    Крыса CD68 Джин ORF экспрессии кДНК клона плазмидыRG80307-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Macrosialin, also known as CD68 and Gp110, is a single-pass type I  membrane protein which belongs to the LAMP family. CD68 is highly expressed by blood monocytes and tissue macrophages. It is also expressed in lymphocytes, fibroblasts and endothelial cells. CD68 is expressed in many tumor cell lines which could allow them to attach to selectins on vascular endothelium, facilitating their dissemination to secondary sites. CD68 plays a role in phagocytic activities of tissue macrophages, both in intracellular lysosomal metabolism and extracellular cell-cell and cell-pathogen interactions. It is a commonly used marker for macrophages. However, a number of studies have shown that CD68 antibodies react with other hematopoietic and non-hematopoietic cell types, suggesting that CD68 may not be a macrophage-specific antigen. CD68 binds to tissue- and organ-specific lectins or selectins, allowing homing of macrophage subsets to particular sites. Rapid recirculation of CD68 from endosomes and lysosomes to the plasma membrane may allow macrophages to crawl over selectin-bearing substrates or other cells.

    Ссылки
  • Strobl H. et al., 1995, Br J Haematol. 90 (4): 774-82.
  • Ogawa Y. et al., 1995, Pathol Int. 45 (9): 698-701.
  • Sadovnikova E. et al., 2002,Leukemia. 16 (10): 2019-26.
  • Gottfried E. et al., 2008, Scand J Immunol. 67 (5): 453-63.
  • Strojnik T. et al., 2009, Anticancer Res. 29 (8): 3269-79.
  • Size / Price
    Каталог: RG80307-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».