After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD63 Информация о продукте «Клон cDNA»
Размер кДНК:717bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd63 molecule with C terminal His tag.
Синоним гена:MGC72893, Cd63
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80304-ACGRBS15400
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80304-ACRRBS15400
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80304-CFRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80304-CHRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80304-CMRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80304-CYRBS13340
Крыса CD63 Джин клон кДНК в вектор клонированияRG80304-GRBS5130
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80304-NFRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80304-NHRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80304-NMRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80304-NYRBS13340
Крыса CD63 Джин ORF экспрессии кДНК клона плазмидыRG80304-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 63 (CD63) is a member of the CD family and the transmembrane 4 superfamily,also known as the tetraspanin family. CD63 is a cellular surface glycoprotein characterized by the presence of four bydrophobic domains. CD63 had functions in mediating signal transduction processes and then regulate variety of cellular processes such as cell proliferation, activation and motility. It has reported that CD63 protein associated with tumor progression and served as a blood platlet activation marker and the deficiency of this protein may be associated with Hermansky-Pudlak syndrome.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Radford KJ, et al. (1996) Associates with Transmembrane 4 Superfamily Members, CD9 and CD81, and with beta 1 Integrins in Human Melanoma. Biochemical Biophysical Research Communications. 222(1): 13-18.
  • Metzelaar MJ, et al. (1991) CD63 antigen, A novel lysosomal membrane glycoprotein, cloned by a screening procedure for intracellular antigens in eukaryotic cells. The journal of biological chemistry. 266: 3239-45.
  • Size / Price
    Каталог: RG80304-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.