CD6 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80311-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CD6 Reagents

CRO Services

Product recommended


All CD6 Reagents

CD6 cDNA ORF Clone, Rat, C-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1998 bp
Description
Full length Clone DNA of Rat Cd6 molecule with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD6 Background Information

T-cell differentiation antigen CD6, also known as TP12 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP12 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP12 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP12 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP12 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.
Full Name
CD6 molecule
References
  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • CD6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CD6 cDNA ORF Clone in Cloning Vector, Rat RG80311-G
    CD6 cDNA ORF Clone, Rat, untagged RG80311-UT
    CD6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80311-ACGLN
    CD6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80311-ACG
    CD6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80311-ACR
    CD6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80311-CF
    CD6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80311-NF
    CD6 cDNA ORF Clone, Rat, C-His tag RG80311-CH
    CD6 cDNA ORF Clone, Rat, N-His tag RG80311-NH
    CD6 cDNA ORF Clone, Rat, N-HA tag RG80311-NY
    CD6 cDNA ORF Clone, Rat, C-Myc tag RG80311-CM
    CD6 cDNA ORF Clone, Rat, N-Myc tag RG80311-NM
    CD6 qPCR Primer Pairs, Rat RP300399

    CD6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD6 cDNA ORF Clone in Cloning Vector, Mouse MG50711-G
    CD6 cDNA ORF Clone, Mouse, untagged MG50711-UT
    CD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50711-ACGLN
    CD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50711-ACG
    CD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50711-ACR
    CD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50711-CF
    CD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50711-NF
    CD6 cDNA ORF Clone, Mouse, C-His tag MG50711-CH
    CD6 cDNA ORF Clone, Mouse, N-His tag MG50711-NH
    CD6 cDNA ORF Clone, Mouse, C-HA tag MG50711-CY
    CD6 cDNA ORF Clone, Mouse, N-HA tag MG50711-NY
    CD6 cDNA ORF Clone, Mouse, C-Myc tag MG50711-CM
    CD6 cDNA ORF Clone, Mouse, N-Myc tag MG50711-NM
    CD6 qPCR Primer Pairs, Mouse MP200686

    CD6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD6 cDNA ORF Clone in Cloning Vector, Human HG17051-G
    CD6 cDNA ORF Clone, Human, untagged HG17051-UT
    CD6 cDNA ORF Clone, Human, C-GFPSpark® tag HG17051-ACG
    CD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17051-ACGLN
    CD6 cDNA ORF Clone, Human, C-OFPSpark® tag HG17051-ACR
    CD6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17051-CF
    CD6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17051-NF
    CD6 cDNA ORF Clone, Human, C-His tag HG17051-CH
    CD6 cDNA ORF Clone, Human, N-His tag HG17051-NH
    CD6 cDNA ORF Clone, Human, C-HA tag HG17051-CY
    CD6 cDNA ORF Clone, Human, N-HA tag HG17051-NY
    CD6 cDNA ORF Clone, Human, C-Myc tag HG17051-CM
    CD6 cDNA ORF Clone, Human, N-Myc tag HG17051-NM
    info info
    添加购物车成功! 添加购物车失败!