Быстрый заказ

Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD6 Информация о продукте «Клон cDNA»
Размер кДНК:1998bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd6 molecule with N terminal His tag.
Синоним гена:OX52, MGC108551, Cd6
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80311-ACGRBS16760
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80311-ACRRBS16760
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80311-CFRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80311-CHRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80311-CMRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80311-CYRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин клон кДНК в вектор клонированияRG80311-GRBS5130
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80311-NFRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80311-NHRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80311-NMRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80311-NYRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмидыRG80311-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    Каталог: RG80311-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.