After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_175577.3
Размер кДНК:1998bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd6 molecule with C terminal HA tag.
Синоним гена:OX52, MGC108551, Cd6
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80311-ACGRBS16764
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80311-ACRRBS16760
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80311-CFRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80311-CHRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80311-CMRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80311-CYRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин клон кДНК в вектор клонированияRG80311-GRBS5130
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80311-NFRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80311-NHRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80311-NMRBS14710
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80311-NYRBS14711
Крыса CD6 / Cluster of Differentiation 6 Джин ORF экспрессии кДНК клона плазмидыRG80311-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

Ссылки
  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    Каталог: RG80311-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».