Быстрый заказ

Text Size:AAA

Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD59 Информация о продукте «Клон cDNA»
Размер кДНК:381bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD59 molecule, complement regulatory protein with C terminal His tag.
Синоним гена:Cd59a, Cd59b, MACIF, MACIP, MAC-IP, Cd59
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80299-ACGRBS15400
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80299-ACRRBS15400
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80299-CFRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80299-CHRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80299-CMRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80299-CYRBS13340
Крыса CD59 Джин клон кДНК в вектор клонированияRG80299-GRBS5130
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80299-NFRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80299-NHRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80299-NMRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80299-NYRBS13340
Крыса CD59 Джин ORF экспрессии кДНК клона плазмидыRG80299-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
  • Size / Price
    Каталог: RG80299-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.