CD55 / DAF cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

CD55 / DAF cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Description
Full length Clone DNA of Rat Cd55 molecule with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD55 / DAF Background Information

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 3 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 7-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.
Full Name
CD55 molecule, decay accelerating factor for complement (Cromer blood group)
References
  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait