After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD55 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022269.2
Размер кДНК:1200bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd55 molecule with C terminal HA tag.
Синоним гена:Daf, Daf1, Cd55
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80317-ACGRBS15400
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80317-ACRRBS15400
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80317-CFRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80317-CHRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80317-CMRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80317-CYRBS13340
Крыса CD55/DAF Джин клон кДНК в вектор клонированияRG80317-GRBS5130
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80317-NFRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80317-NHRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80317-NMRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80317-NYRBS13340
Крыса CD55/DAF Джин ORF экспрессии кДНК клона плазмидыRG80317-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD55, also well known as decay-accelerating factor (DAF), is a member of the RCA (regulators of complement activation) family characterized by four to 30 SCRs (short consensus repeats) in their plasma-exposed regions. It is a major regulator of the alternative and classical pathways of complement activation and is expressed on all serum-exposed cells. CD55 is physiologically acting as an inhibitor of the complement system, but is also broadly expressed in malignant tumours. DAF seems to exert different functions beyond its immunological role such as promotion of tumorigenesis, decrease of complement mediated tumor cell lysis, autocrine loops for cell rescue and evasion of apoptosis, neoangiogenesis, invasiveness, cell motility. It is commonly hijacked by invading pathogens, including many enteroviruses and uropathogenic Escherichia coli, to promote cellular attachment prior to infection. This 70-75 kDa glycoprotein CD55 containing four SCR modules is involved in the regulation of the complement cascade. It inhibits complement activation by suppressing the function of C3/C5 convertases, thereby limiting local generation or deposition of C3a/C5a and membrane attack complex (MAC or C5b-9) production. DAF has been identified as a ligand for an activation-associated, seven-transmembrane lymphocyte receptor, CD97, which is a receptor mediating attachment and infection of several viruses and bacteria. In addition, it has been shown that DAF regulates the interplay between complement and T cell immunity in vivo, and thus may be implicated in immune and tumor biology.

Ссылки
  • Lea S. (2002) Interactions of CD55 with non-complement ligands. Biochem Soc Trans. 30(Pt 6): 1014-9.
  • Mikesch JH, et al. (2006) The expression and action of decay-accelerating factor (CD55) in human malignancies and cancer therapy. Cell Oncol. 28(5-6): 223-32.
  • Wang Y, et al. (2010) Decay accelerating factor (CD55) protects neuronal cells from chemical hypoxia-induced injury. J Neuroinflammation. 7:24.
  • Size / Price
    Каталог: RG80317-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».