After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD53 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012523.1
Размер кДНК:660bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd53 molecule with C terminal His tag.
Синоним гена:OX44, Ox-44, RATOX44, Cd53
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80303-ACGRBS15400
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80303-ACRRBS15400
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80303-CFRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80303-CHRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80303-CMRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80303-CYRBS13340
Крыса CD53 Джин клон кДНК в вектор клонированияRG80303-GRBS5130
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80303-NFRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80303-NHRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80303-NMRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80303-NYRBS13340
Крыса CD53 Джин ORF экспрессии кДНК клона плазмидыRG80303-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

Ссылки
  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • Size / Price
    Каталог: RG80303-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».