After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD52 Информация о продукте «Клон cDNA»
Размер кДНК:291bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD52 antigen with C terminal His tag.
Синоним гена:B7, Cd52
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80298-ACGRBS15400
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80298-ACRRBS15400
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80298-CFRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80298-CHRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80298-CMRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80298-CYRBS13340
Крыса CD52 / CDW52 Джин клон кДНК в вектор клонированияRG80298-GRBS5130
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80298-NFRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80298-NHRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80298-NMRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80298-NYRBS13340
Крыса CD52 / CDW52 Джин ORF экспрессии кДНК клона плазмидыRG80298-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
  • Size / Price
    Каталог: RG80298-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.