After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD5 Информация о продукте «Клон cDNA»
Размер кДНК:1476bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd5 molecule with C terminal HA tag.
Синоним гена:MGC114334, Cd5
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80374-ACGRBS15400
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80374-ACRRBS15400
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80374-CFRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80374-CHRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80374-CMRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80374-CYRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин клон кДНК в вектор клонированияRG80374-GRBS5130
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80374-NFRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80374-NHRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80374-NMRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80374-NYRBS13340
Крыса CD5 / Cluster of Differentiation 5 Джин ORF экспрессии кДНК клона плазмидыRG80374-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Каталог: RG80374-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.