Быстрый заказ

Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD48 Информация о продукте «Клон cDNA»
Размер кДНК:723bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd48 molecule with C terminal His tag.
Синоним гена:Cd48
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80286-ACGRBS15400
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80286-ACRRBS15400
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80286-CFRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80286-CHRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80286-CMRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80286-CYRBS13340
Крыса CD48/Blast-1 Джин клон кДНК в вектор клонированияRG80286-GRBS5130
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80286-NFRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80286-NHRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80286-NMRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80286-NYRBS13340
Крыса CD48/Blast-1 Джин ORF экспрессии кДНК клона плазмидыRG80286-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • Size / Price
    Каталог: RG80286-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.