Быстрый заказ

Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CD47 Информация о продукте «Клон cDNA»
    Размер кДНК:912bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd47 molecule with N terminal His tag.
    Синоним гена:Itgp, MGC93490, Cd47
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with CD47 qPCR primers for gene expression analysis, RP300281 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80305-ACGRBS15400
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80305-ACRRBS15400
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80305-CFRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80305-CHRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80305-CMRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80305-CYRBS13340
    Крыса CD47 Джин клон кДНК в вектор клонированияRG80305-GRBS5130
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80305-NFRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80305-NHRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80305-NMRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80305-NYRBS13340
    Крыса CD47 Джин ORF экспрессии кДНК клона плазмидыRG80305-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Каталог: RG80305-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.