After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD47 Информация о продукте «Клон cDNA»
Размер кДНК:912bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd47 molecule with N terminal His tag.
Синоним гена:Itgp, MGC93490, Cd47
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80305-ACGRBS15400
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80305-ACRRBS15400
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80305-CFRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80305-CHRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80305-CMRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80305-CYRBS13340
Крыса CD47 Джин клон кДНК в вектор клонированияRG80305-GRBS5130
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80305-NFRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80305-NHRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80305-NMRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80305-NYRBS13340
Крыса CD47 Джин ORF экспрессии кДНК клона плазмидыRG80305-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Каталог: RG80305-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.