Быстрый заказ

Крыса CD40 Ligand/CD40L/CD154 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CD40LG Информация о продукте «Клон cDNA»
    Размер кДНК:783bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus CD40 ligand with N terminal Flag tag.
    Синоним гена:Tnfsf5, Cd40lg
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    ( We provide with CD40LG qPCR primers for gene expression analysis, RP300146 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Proteins
    Immune Checkpoint Targets   Co-stimulatory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.