CD40 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

CD40 cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Rat CD40 molecule, TNF receptor superfamily member 5 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD40 Background Information

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.
Full Name
CD40 molecule, TNF receptor superfamily member 5
References
  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.

CD40 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait