After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD40 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_134360.1
Размер кДНК:870bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD40 molecule, TNF receptor superfamily member 5 with N terminal Flag tag.
Синоним гена:Tnfrsf5, Cd40
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80151-ACGRBS15400
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80151-ACRRBS15400
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80151-CFRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80151-CHRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80151-CMRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80151-CYRBS13340
Крыса CD40/TNFRSF5 Джин клон кДНК в вектор клонированияRG80151-GRBS5130
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80151-NFRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80151-NHRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80151-NMRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80151-NYRBS13340
Крыса CD40/TNFRSF5 Джин ORF экспрессии кДНК клона плазмидыRG80151-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

Ссылки
  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • Size / Price
    Каталог: RG80151-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».