Быстрый заказ

Text Size:AAA

Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD36 Информация о продукте «Клон cDNA»
Размер кДНК:1419bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD36 molecule (thrombospondin receptor) with C terminal His tag.
Синоним гена:Fat, MGC91634, MGC108510, Cd36
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80263-ACGRBS15396
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80263-ACRRBS15396
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80263-CFRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80263-CHRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80263-CMRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80263-CYRBS13343
Крыса CD36/SCARB3 Джин клон кДНК в вектор клонированияRG80263-GRBS5132
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80263-NFRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80263-NHRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80263-NMRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80263-NYRBS13343
Крыса CD36/SCARB3 Джин ORF экспрессии кДНК клона плазмидыRG80263-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 36 (CD36), also known as FAT, SCARB3, GP88, glycoprotein IV (gpIV) and glycoprotein IIIb (gpIIIb), is a member of the CD system as well as the class B scavenger receptor family of cell surface proteins. CD36 can be found on the surface of many cell types in vertebrate animals and it consists of 472 amino acids and is extensively glycosylated. It is an integral membrane protein primarily serving as receptors for thrombospondin and collagen and by the erythrocytes infected with the human malaria parasite. The role of CD36 as a cell surface receptor has been extended to that of a signal transduction molecule.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Greenwalt RH, et al. (1992) Membrane glycoprotein in CD36: a review of its roles in adherence, signal transduction, and transfusion medicine. The journal of the American society of hematology. 80 (5): 1105-15.
  • Size / Price
    Каталог: RG80263-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.