After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD34 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001107202.2
Размер кДНК:1161bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD34 molecule.
Синоним гена:Cd34
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80262-ACGRBS15400
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80262-ACRRBS15400
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80262-CFRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80262-CHRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80262-CMRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80262-CYRBS13340
Крыса CD34 Джин клон кДНК в вектор клонированияRG80262-GRBS5130
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80262-NFRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80262-NHRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80262-NMRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80262-NYRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмидыRG80262-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

Ссылки
  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • Size / Price
    Каталог: RG80262-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».