Быстрый заказ

Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD34 Информация о продукте «Клон cDNA»
Размер кДНК:1161bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD34 molecule with C terminal His tag.
Синоним гена:Cd34
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80262-ACGRBS15400
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80262-ACRRBS15400
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80262-CFRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80262-CHRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80262-CMRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80262-CYRBS13340
Крыса CD34 Джин клон кДНК в вектор клонированияRG80262-GRBS5130
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80262-NFRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80262-NHRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80262-NMRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80262-NYRBS13340
Крыса CD34 Джин ORF экспрессии кДНК клона плазмидыRG80262-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cluster of Differentiation 34 (CD34) is a member of a family of single-pass transmembrane sialomucin proteins, and may function as a cell-cell adhesion factor. CD34 protein is selectively expressed on hematopoietic progenitor cells and the small vessel endothelium of a variety of tissues. It has been widely used as a stem and progenitor cell marker, and clinical CD34+ stem cell transplantation (CD34+SCT) has been performed for tumor purging. CD34 monoclonal antibodies are widely used to identify and isolate hemopoietic progenitors and to classify acute and chronic leukemias.

  • Hogan CJ, et al. (2002) Differential long-term and multilineage engraftment potential from subfractions of human CD34+ cord blood cells transplanted into NOD/SCID mice. Proc Nat Acad Sci USA. 99 (1): 413-8.
  • Nielsen JS,et al. (2009) CD34 is a key regulator of hematopoietic stem cell trafficking to bone marrow and mast cell progenitor trafficking in the periphery. Microcirculation. 16(6): 487-96.
  • Mastrandrea F,et al. (2009) CD34+ hemopoietic precursor and stem cells traffic in peripheral blood of celiac patients is significantly increased but not directly related to epithelial damage severity. Eur Ann Allergy Clin Immunol. 40(3): 90-103.
  • Pasquet S,et al. (2009) Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor-mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy. 11(8): 1002-15.
  • Size / Price
    Каталог: RG80262-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.