After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD320 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001014201.1
Размер кДНК:795bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD320 molecule with C terminal HA tag.
Синоним гена:RGD1305860, Cd320
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80375-ACGRBS15400
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80375-ACRRBS15400
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80375-CFRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80375-CHRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80375-CMRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80375-CYRBS13340
Крыса CD320/8D6 antigen Джин клон кДНК в вектор клонированияRG80375-GRBS5130
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80375-NFRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80375-NHRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80375-NMRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80375-NYRBS13340
Крыса CD320/8D6 antigen Джин ORF экспрессии кДНК клона плазмидыRG80375-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80375-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».