After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD28 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013121.1
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Cd28 molecule with C terminal His tag.
Синоним гена:CD28RNA, Cd28
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80302-ACGRBS15400
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80302-ACRRBS15400
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80302-CFRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80302-CHRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80302-CMRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80302-CYRBS13340
Крыса CD28/TP44 Джин клон кДНК в вектор клонированияRG80302-GRBS5130
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80302-NFRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80302-NHRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80302-NMRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80302-NYRBS13340
Крыса CD28/TP44 Джин ORF экспрессии кДНК клона плазмидыRG80302-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

Ссылки
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • Size / Price
    Каталог: RG80302-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».