After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD274 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001191954.1
Размер кДНК:873bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD274molecule with N terminal HA tag.
Синоним гена:Pdcd1lg1, RGD1566211, Cd274
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80450-ACGRBS15396
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80450-ACRRBS15396
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80450-CFRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80450-CHRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80450-CMRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80450-CYRBS13343
Крыса PD-L1/B7-H1/CD274 Джин клон кДНК в вектор клонированияRG80450-GRBS5132
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80450-NFRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80450-NHRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80450-NMRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80450-NYRBS13343
Крыса PD-L1/B7-H1/CD274 Джин ORF экспрессии кДНК клона плазмидыRG80450-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

Ссылки
  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • Size / Price
    Каталог: RG80450-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».