After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD24 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012752.3
Размер кДНК:231bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD24 molecule with N terminal His tag.
Синоним гена:Cd24a, MGC93641, Cd24
Виды:Rat
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80297-ACGRBS15396
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80297-ACRRBS15396
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80297-CFRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80297-CHRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80297-CMRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80297-CYRBS13343
Крыса CD24 Джин клон кДНК в вектор клонированияRG80297-GRBS5132
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80297-NFRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80297-NHRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80297-NMRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80297-NYRBS13343
Крыса CD24 Джин ORF экспрессии кДНК клона плазмидыRG80297-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 24, also known as signal transducer CD24 or heat stable antigen CD24 (HSA), is a mucin-type glycosylphosphatidylinositol-linked glycoprotein expressed on the surface of B-cells, differentiating neuroblasts and many tumors. It is involved in molecular adhesion and metastatic tumor spread and serve as a normal receptor for P-selectin. The CD24 / P-selectin pathway could be important in dissimenating of tumor cells by facilitating the interaction with platelet and endothelial cells. It has also been considered as a tumor marker. High rate of CD24 expressions have been found in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer.

Ссылки
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Kristiansen G, et al. (2003) Tumour biological aspects of CD24, a mucin-like adhesion molecule. Journal of molecular histology. 35 (3): 255-62.
  • Size / Price
    Каталог: RG80297-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».