Быстрый заказ

Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CD14 Информация о продукте «Клон cDNA»
Размер кДНК:1119bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus CD14 molecule with C terminal His tag.
Синоним гена:Cd14
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80308-ACGRBS15400
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80308-ACRRBS15400
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80308-CFRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80308-CHRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80308-CMRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80308-CYRBS13340
Крыса CD14 Джин клон кДНК в вектор клонированияRG80308-GRBS5130
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80308-NFRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80308-NHRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80308-NMRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80308-NYRBS13340
Крыса CD14 Джин ORF экспрессии кДНК клона плазмидыRG80308-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 14 (CD14) is a member of the CD system. It takes its name from its inclusion in the CD molecule surface marker proteins. CD14 exists in two forms: a form anchored into the membrane or a soluble form. CD14 was found expressed in macrophages, neutrophil granulocyte and dendritic cells. The major function is serve as a co-receptor (along with TLR4 and MD-2) for the bacterial lipopolysaccharide (LPS) and other pathogen-associated molecular patterns.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • SD Wright, et al. (1990) CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 249 (4975): 1431-3.
  • Size / Price
    Каталог: RG80308-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.