Быстрый заказ

Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса CCR4 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_133532.2
    Размер кДНК:1083bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) receptor 4 with C terminal HA tag.
    Синоним гена:Cmkbr4, Ccr4
    Виды:Rat
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CCR4 qPCR primers for gene expression analysis, RP300327 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80357-ACGRBS15400
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80357-ACRRBS15400
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80357-CFRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80357-CHRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80357-CMRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80357-CYRBS13340
    Крыса CCR4 Джин клон кДНК в вектор клонированияRG80357-GRBS5130
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80357-NFRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80357-NHRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80357-NMRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80357-NYRBS13340
    Крыса CCR4 Джин ORF экспрессии кДНК клона плазмидыRG80357-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CCR4 is a chemokine receptor that has a critical role in immune cell trafficking. T-helper type 2 cells (Th2), regulatory T cells (Treg), interluekin-17–producing T-helper cells (Th17), and skin-homing memory T cells express CCR4 on their surface and migrate toward the chemokines CCL17 and CCL22.
    CCR4, a C-C type chemokine receptor, has previously been focused on its biological function in immunopathogenesis of hematological tumors. To date, relatively little attention has been paid to the role of CCR4 in promoting metastasis of some solid tumors, including gastric cancer. Our group has shown that the lymphocyte-rich gastric cancers tend to be more frequently positive for CCR4, and found a novel role of CCR4 in tumor-induced immunosuppression, indicating various expression profiles of CCR4 in gastric cancer tissues and multifunctional roles of this molecule in gastric cancer progression.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Yang Y, Du L, Yang X, et al. Aberrant CCR4 Expression Is Involved in Tumor Invasion of Lymph Node-Negative Human Gastric Cancer. Tang C-H, ed. PLoS ONE. 2015;10(3):e0120059. doi:10.1371/journal.pone.0120059.
  • Nakagawa M, Schmitz R, Xiao W, et al. Gain-of-function CCR4 mutations in adult T cell leukemia/lymphoma. The Journal of Experimental Medicine. 2014;211(13):2497-2505.
  • Size / Price
    Каталог: RG80357-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».