After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat CCL6 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC079460.1
Размер кДНК:348bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus chemokine (C-C motif) ligand 6 with N terminal Myc tag.
Синоним гена:Mrp-1, Scay6
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80721-ACGRBS15400
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80721-ACRRBS15400
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80721-CFRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80721-CHRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80721-CMRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80721-CYRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80721-NFRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80721-NHRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80721-NMRBS13340
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80721-NYRBS13340
Крыса CCL6/C10 Джин клон кДНК в вектор клонированияRG80721-URBS5130
Крыса CCL6/C10 Джин ORF экспрессии кДНК клона плазмидыRG80721-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Chemokine (C-C motif) ligand 6 (CCL6), also known as C-C chemokine C10 has only been identified in rodents, which is a small cytokine belonging to the CC chemokine family, beta-chemokine subfamily. C-C chemokine C10 is involved in the chronic stages of host defense reactions. C10 chemokine rapidly promotes disease resolution in the cecal ligation and puncture (CLP) model through its direct effects on the cellular events critically involved in host defense during septic peritonitis. CCL6 appears to contribute to the macrophage infiltration that is independent of other CC chemokines. C10 is a prominent chemokine expressed in the central nervous system in experimental inflammatory demyelinating disease, also acts as a potent chemotactic factor for the migration of these leukocytes to the brain. CCL6 may be a mediator released by microglia for cell-cell communication under physiological as well as pathological conditions of CNS. Additionally, the chemokine CCL6 may alter tumor behavior by relieving its growth factor dependency and by promoting invasiveness as a result of local tissue apoptosis.

Ссылки
  • Asensio VC, et al. (1999) C10 is a novel chemokine expressed in experimental inflammatory demyelinating disorders that promotes recruitment of macrophages to the central nervous system. Am J Pathol. 154(4): 1181-91.
  • Steinhauser ML, et al. (2000) Chemokine C10 promotes disease resolution and survival in an experimental model of bacterial sepsis. Infect Immun. 68(11): 6108-14.
  • Yi F, et al. (2003) The CCL6 chemokine is differentially regulated by c-Myc and L-Myc, and promotes tumorigenesis and metastasis. Cancer Res. 63(11): 2923-32.
  • LaFleur AM, et al. (2004) Role of CC chemokine CCL6/C10 as a monocyte chemoattractant in a murine acute peritonitis. Mediators Inflamm. 13(5-6): 349-55.
  • Kanno M, et al. (2005) Functional expression of CCL6 by rat microglia: a possible role of CCL6 in cell-cell communication. J Neuroimmunol. 167(1-2): 72-80.
  •  

    CCL6/C10 related areas, pathways, and other information

    Size / Price
    Каталог: RG80721-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».