Calpain 6/CAPN6 cDNA ORF Clone, Rat, C-His tag

Price:
Size:
Number:

Calpain 6/CAPN6 cDNA ORF Clone, Rat, C-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1926 bp
Description
Full length Clone DNA of Rat calpain 6 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Calpain 6/CAPN6 Background Information

Calpains are Ca(2+)-dependent modulator Cys proteases that have a variety of functions in almost all eukaryotes. There are more than 1 well-conserved mammalian calpains, among which eutherian calpain-6 (CAPN6) is unique in that it has amino acid substitutions at the active-site Cys residue (to Lys in humans), strongly suggesting a loss of proteolytic activity. CAPN6 is expressed predominantly in embryonic muscles, placenta, and several cultured cell lines. The inflammatory cytokines induce an unconventional nonproteolytic calpain, calpain-6 (CAPN6), which associates with the essential EJC-loading factor CWC22 in the cytoplasm. This association disturbs the nuclear localization of CWC22, thereby suppressing the splicing of target genes, including those related to Rac1 signaling. CAPN6 deficiency in LDL receptor-deficient mice restored CWC22/EJC/Rac1 signaling, reduced pinocytotic deposition of native LDL in macrophages, and attenuated macrophage recruitment into the lesions, generating an atheroprotective phenotype in the aorta. That CAPN6 promotes atherogenicity in inflamed macrophages by disturbing CWC22/EJC systems. Alpain 6 (CAPN6) expression is regulated by PI3K-Akt in liver cancer through POU2F1 and CAPN6 which promote cell proliferation and inhibit apoptosis of liver cancer cells. Loss of CAPN6 promotes skeletal muscle differentiation during both development and regeneration, suggesting a novel physiological function of CAPN6 as a suppressor of skeletal muscle differentiation. CAPN6 promoted cancer cell proliferation and inhibited its apoptosis. CAPN6 acts as a potential regulator of Rac1 activity, through a mechanism involving interaction with GEF-H1, to control lamellipodial formation and cell motility.
Full Name
calpain 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait