After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat BNIP3L Информация о продукте «Клон cDNA»
Размер кДНК:657bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus BCL2/adenovirus E1B interacting protein 3-like with C terminal Flag tag.
Синоним гена:Nix
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81156-ACGRBS15400
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81156-ACRRBS15400
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81156-ANGRBS15400
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81156-ANRRBS15400
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81156-CFRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81156-CHRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81156-CMRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81156-CYRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81156-NFRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81156-NHRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81156-NMRBS13340
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81156-NYRBS13340
Крыса BNIP3L Джин клон кДНК в вектор клонированияRG81156-URBS5130
Крыса BNIP3L Джин ORF экспрессии кДНК клона плазмидыRG81156-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
  • Imazu T, et al. (1999) Bcl-2 / E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl-2 / Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene. 18(32): 4523-9.
  • Sun JL, et al. (2004) Expression and structure of BNIP3L in lung cancer. Ai Zheng. 23(1): 8-14.
  • Size / Price
    Каталог: RG81156-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.