Apolipoprotein H cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

Apolipoprotein H cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Description
Full length Clone DNA of Rat apolipoprotein H (beta-2-glycoprotein I) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Apolipoprotein H Background Information

Apolipoprotein H (APOH), also known as Beta-2-glycoprotein 1, Activated protein C-binding protein, B2GPI, and B2G1, is a glycoprotein synthesized by liver cells and it is present in the blood associated with plasma lipoproteins. It is an essential cofactor for the binding of certain antiphospholipid antibodies (APA) to anionic phospholipid. APOH binds to various kinds of negatively charged substances such as heparin, phospholipids, and dextran sulfate. APOH may prevent activation of the intrinsic blood coagulation cascade by binding to phospholipids on the surface of damaged cells. APOH appears to completely inhibit serotonin release by the platelets and prevents subsequent waves of the ADP-induced aggregation. The activity of APOH appears to involve the binding of agglutenating, negatively charged compounds, and inhibits agglutenation by the contact activation of the intrinsic blood coagulation pathway. APOH causes a reduction of the prothrombinase binding sites on platelets and reduces the activation caused by collagen when thrombin is present at physiological serum concentrations of APOH suggesting a regulatory role of APOH in coagulation. APOH plasma concentrations are strongly associated to metabolic syndrome alterations and vascular disease in type 2 diabetic and could be considered as a clinical marker of cardiovascular risk. APOH is found on several classes of lipoproteins, and is involved in the activation of lipoprotein lipase in lipid metabolism. This single-chain glycoprotein also has been implicated in several physiologic pathways including coagulation and the production of hypertension, which are related to the pathogenesis of primary cerebral hemorrhage (PICH).
Full Name
apolipoprotein H (beta-2-glycoprotein I)
References
  • Kamboh MI, et al. (1998) Genetics of apolipoprotein H (beta2-glycoprotein I) and anionic phospholipid binding. Lupus. 7 Suppl 2: S10-3.
  • Singh P, et al. (2002) Genetics of apolipoprotein H (beta2-glycoprotein I) polymorphism in India. Ann Hum Biol. 29(3): 247-55.
  • Xia J, et al. (2004) Apolipoprotein H gene polymorphisms and risk of primary cerebral hemorrhage in a Chinese population. Cerebrovasc Dis. 17(2-3): 197-203.
  • Chen Q, et al. (2006) Complete DNA sequence variation in the apolipoprotein H (beta-glycoprotein I) gene and identification of informative SNPs. Ann Hum Genet. 70(Pt 1): 1-11.
  • Leduc MS, et al. (2008) Comprehensive evaluation of apolipoprotein H gene (APOH) variation identifies novel associations with measures of lipid metabolism in GENOA. J Lipid Res. 49(12): 2648-56.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait