After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat APOC2 Информация о продукте «Клон cDNA»
Размер кДНК:294bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus apolipoprotein C-II with N terminal Myc tag.
Синоним гена:Apoc2
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80696-ACGRBS15400
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80696-ACRRBS15400
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80696-CFRBS13340
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80696-CHRBS13343
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80696-CMRBS13340
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80696-CYRBS13343
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80696-NFRBS13343
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80696-NHRBS13343
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80696-NMRBS13343
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80696-NYRBS13343
Крыса APOC2/Apolipoprotein CII Джин клон кДНК в вектор клонированияRG80696-URBS5132
Крыса APOC2/Apolipoprotein CII Джин ORF экспрессии кДНК клона плазмидыRG80696-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80696-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.