Быстрый заказ

Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса APEX1 Информация о продукте «Клон cDNA»
    Размер кДНК:954bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus APEX nuclease (multifunctional DNA repair enzyme) 1 with N terminal Myc tag.
    Синоним гена:APE, Apex, REF-1
    Участок рестрикции:
    Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Описание последовательности:
    ( We provide with APEX1 qPCR primers for gene expression analysis, RP300720 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80756-ACGRBS15400
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80756-ACRRBS15400
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80756-ANGRBS15400
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80756-ANRRBS15400
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80756-CFRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80756-CHRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80756-CMRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80756-CYRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80756-NFRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80756-NHRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80756-NMRBS13340
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80756-NYRBS13340
    Крыса APEX1/APE1/Ref-1 Джин клон кДНК в вектор клонированияRG80756-URBS5130
    Крыса APEX1/APE1/Ref-1 Джин ORF экспрессии кДНК клона плазмидыRG80756-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name

    The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    Каталог: RG80756-NM
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.