Быстрый заказ

Text Size:AAA

Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ALB Информация о продукте «Клон cDNA»
Размер кДНК:1827bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus albumin with N terminal HA tag.
Синоним гена:Alb1, Albza
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80495-ACGRBS16760
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80495-ACRRBS16760
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80495-CFRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80495-CHRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80495-CMRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80495-CYRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80495-NFRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80495-NHRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80495-NMRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80495-NYRBS14710
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин клон кДНК в вектор клонированияRG80495-URBS5130
Крыса Человек Serum Albumin / HSA / HAS / ALB Джин ORF экспрессии кДНК клона плазмидыRG80495-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80495-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.