After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat AKR7A3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013215.1
Размер кДНК:984bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) with C terminal His tag.
Синоним гена:Afar, Akr7a1
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81626-ACGRBS15400
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81626-ACRRBS15400
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81626-CFRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81626-CHRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81626-CMRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81626-CYRBS13340
Крыса AKR7A3 Джин клон кДНК в вектор клонированияRG81626-GRBS5130
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81626-NFRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81626-NHRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81626-NMRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81626-NYRBS13340
Крыса AKR7A3 Джин ORF экспрессии кДНК клона плазмидыRG81626-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81626-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».