After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat AGA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001031641.1
Размер кДНК:1038bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus aspartylglucosaminidase with N terminal Flag tag.
Синоним гена:Aga
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81623-ACGRBS15400
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81623-ACRRBS15400
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81623-CFRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81623-CHRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81623-CMRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81623-CYRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин клон кДНК в вектор клонированияRG81623-GRBS5130
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81623-NFRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81623-NHRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81623-NMRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81623-NYRBS13340
Крыса ASRG / Aspartylglucosaminidase Джин ORF экспрессии кДНК клона плазмидыRG81623-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.

Human Protein S100-A8, also known as S100 calcium-binding protein A8, Cystic fibrosis antigen, Migration inhibitory factor-related protein 8, S100A8, and CAGA, is a member of the S-100 family. S100A8 plays a role in various functions of myeloid cells by forming a heterocomplex with S100A9. S100A8 and S100A9 are known to be overexpressed in certain species of carcinomas. S100A8 plays an important role in dedifferentiation of thyroid carcinoma possibly by forming a complex with S100A9. S100A8 and S100A9 may also play a key role in inflammation-associated cancer.

Ссылки
  • Donato, R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Gebhardt, C. et al., 2006,  Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Size / Price
    Каталог: RG81623-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».