Быстрый заказ

Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ADH5 Информация о продукте «Клон cDNA»
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus alcohol dehydrogenase 5 (class III), chi polypeptide with C terminal Myc tag.
Синоним гена:Adh5
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81124-ACGRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81124-ACRRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81124-ANGRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81124-ANRRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81124-CFRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81124-CHRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81124-CMRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81124-CYRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81124-NFRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81124-NHRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81124-NMRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81124-NYRBS13340
Крыса ADH5 Джин клон кДНК в вектор клонированияRG81124-URBS5130
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмидыRG81124-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • Size / Price
    Каталог: RG81124-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.