Быстрый заказ

Text Size:AAA

Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ADH5 Информация о продукте «Клон cDNA»
Размер кДНК:1125bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus alcohol dehydrogenase 5 (class III), chi polypeptide with C terminal Flag tag.
Синоним гена:Adh5
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81124-ACGRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81124-ACRRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81124-ANGRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81124-ANRRBS15400
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81124-CFRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81124-CHRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81124-CMRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81124-CYRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81124-NFRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81124-NHRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81124-NMRBS13340
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81124-NYRBS13340
Крыса ADH5 Джин клон кДНК в вектор клонированияRG81124-URBS5130
Крыса ADH5 Джин ORF экспрессии кДНК клона плазмидыRG81124-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Carbonic anhydrases IX (CAIX), also known as membrane antigen MN or CA9, is a member of the carbonic anhydrase (CA) family and may be involved in cell proliferation and cellular transformation. CAs are zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide ( H2O + CO2 = H+ + HCO3- ) and thus participate in a variety of biological and physical processes. CAIX is a transmembrane protein structurally consisting of a signal peptide, a proteoglycan-related region, a CA domain with a highly conserved active site, a transmembrane anchor and an intracytoplasmic tail, and is the only tumor-associated CA isoenzyme known so far. Compared with normal tissues, CAIX is overexpressed in a wide spectrum of tumor types and associated with increased metastasis and poor prognosis in aggressive carcinomas. CAIX expression is cell density dependent and has been shown to be strongly induced by hypoxia, accordingly facilitates adaptation of tumor cells to hypoxic conditions. CA9 is regarded as a new therapeutic target for CA9-derived carcinomas.

  • Pastorek, J. et al., 1994, Oncogene. 9: 2877-88.
  • Opavsky, R. et al., 1996, Genomics. 33: 480-7.
  • Swietach, P. et al., 2008, J. Biol. Chem. 283: 20473-83.
  • Robertson, N. et al., 2004, Cancer. Res. 64: 6160-5.
  • Bui, M.H. et al., 2003, Clin. Cancer. Res. 9: 802-11.
  • Choi, S.W. et al., 2008, Hum. Pathol. 39: 1317-22.
  • Size / Price
    Каталог: RG81124-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.