After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ADAM17 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020306.1
Размер кДНК:2484bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ADAM metallopeptidase domain 17 with C terminal HA tag.
Синоним гена:TACE, Adam17
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80350-ACGRBS16760
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80350-ACRRBS16760
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80350-CFRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80350-CHRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80350-CMRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80350-CYRBS14710
Крыса ADAM17 Джин клон кДНК в вектор клонированияRG80350-GRBS5130
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80350-NFRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80350-NHRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80350-NMRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80350-NYRBS14710
Крыса ADAM17 Джин ORF экспрессии кДНК клона плазмидыRG80350-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ADAM17 is a member of the ADAM protein family of disintegrins and metalloproteases. ADAM17 is ubiquitously expressed in the human colon, with increased activity in the colonic mucosa of patients with ulcerative colitis, a main form of inflammatory bowel disease. The expression of ADAM17 may be inhibited by ethanol. It is involved in the processing of tumor necrosis factor alpha (TNF-α) at the surface of the cell, and from within the intracellular membranes of the trans-Golgi network. ADAM17 also plays a role in the release of a diverse variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes. ADAM17 may play a prominent role in the Notch signaling pathway, during the proteolytic release of the Notch intracellular domain (from the Notch1 receptor) that occurs following ligand binding.

Ссылки
  • Poghosyan. et al., 2002, J Biol Chem. 277 (7): 4999-5007.
  • Li Y. et al., 2006, Blood. 108 (7): 2275-9.
  • Peiretti. et al., 2003, J Cell Sci. 116 (10): 1949-57.
  • Size / Price
    Каталог: RG80350-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».