Быстрый заказ

Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ACTR2 Информация о продукте «Клон cDNA»
Размер кДНК:1185bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ARP2 actin-related protein 2 homolog (yeast) with N terminal HA tag.
Синоним гена:Actr2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80467-ACGRBS15400
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80467-ACRRBS15400
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80467-ANGRBS15400
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80467-ANRRBS15400
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80467-CFRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80467-CHRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80467-CMRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80467-CYRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80467-NFRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80467-NHRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80467-NMRBS13340
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80467-NYRBS13340
Крыса Arp2 Джин клон кДНК в вектор клонированияRG80467-URBS5130
Крыса Arp2 Джин ORF экспрессии кДНК клона плазмидыRG80467-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80467-NY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.