ACSL1 cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

ACSL1 cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2100 bp
Description
Full length Clone DNA of Rat acyl-CoA synthetase long-chain family member 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ACSL1 Background Information

Long-chain acyl-CoA synthetases (ACSLs), which are responsible for activation of the most abundant long-chain fatty acids, are commonly deregulated in cancer. This deregulation is also associated with poor survival in patients with cancer. Fatty acids physiologically regulate ACSL expression, but cancer cells could hijack certain involved regulatory mechanisms to deregulate ACSLs. Among the five family isoforms, ACSL1 and ACSL4 are able to promote ungoverned cell growth, facilitate tumor invasion and evade programmed cell death. Acyl-CoA synthetase long-chain family member 1 (ACSL1), which are involved in altered lipid metabolism, lipolysis, and de novo FA synthesis in highly aggressive prostate and breast cancer cells.Global cardiac transcriptional analysis revealed differential expression of genes involved in cardiac metabolism, fibrosis, and hypertrophy development in Acsl1H-/- hearts 2 weeks after Acsl1 ablation.Short-term cardiac-specific ACSL1 inactivation resulted in metabolic and transcriptional derangements distinct from those observed upon complete ACSL1 knockout, suggesting heart-specific mTOR (mechanistic target of rapamycin) signaling that occurs during the early stages of substrate switching. The hypertrophy observed with partial Acsl1 ablation occurs in the context of normal cardiac function and is reminiscent of a physiological process, making this a useful model to study the transition from physiological to pathological hypertrophy. 
Full Name
acyl-CoA synthetase long-chain family member 1
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait