After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ACSL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_012820.1
Размер кДНК:2100bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus acyl-CoA synthetase long-chain family member 1.
Синоним гена:ACS, Acas, COAA, Facl2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81010-ACGRBS16760
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81010-ACRRBS16760
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81010-ANGRBS16760
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81010-ANRRBS16760
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81010-CFRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81010-CHRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81010-CMRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81010-CYRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81010-NFRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81010-NHRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81010-NMRBS14710
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81010-NYRBS14710
Крыса ACSL1 Джин клон кДНК в вектор клонированияRG81010-URBS5130
Крыса ACSL1 Джин ORF экспрессии кДНК клона плазмидыRG81010-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81010-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».