Aconitase 2 cDNA ORF Clone, Rat, C-His tag

Cat: RG80908-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Aconitase 2 Reagents

CRO Services

Product recommended


All Aconitase 2 Reagents

Aconitase 2 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2343 bp
Description
Full length Clone DNA of Rat aconitase 2, mitochondrial with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Aconitase 2 Background Information

A homozygous missense mutation was identified in the ACO2 gene (c.124T>G p.Phe414Val) that segregated with HSP complicated by intellectual disability and microcephaly. Lymphoblastoid cell lines of homozygous carrier patients revealed significantly decreased activity of the mitochondrial aconitase enzyme and defective mitochondrial respiration. ACO2 encodes mitochondrial aconitase, an essential enzyme in the Krebs cycle. Recessive mutations in this gene have been previously associated with cerebellar ataxia. We found homozygous or compound heterozygous missense and frameshift mutations in the gene encoding mitochondrial aconitase (ACO2), a tricarboxylic acid cycle enzyme, catalysing interconversion of citrate into isocitrate. Unlike wild type ACO2, all mutant ACO2 proteins failed to complement the respiratory growth of a yeast aco1-deletion strain. The study shows that autosomal recessive ACO2 mutations can cause either isolated or syndromic optic neuropathy. This observation identifies ACO2 as the second gene responsible for non-syndromic autosomal recessive optic neuropathies and provides evidence for a genetic overlap between isolated and syndromic forms, giving further support to the view that optic atrophy is a hallmark of defective mitochondrial energy supply.
Full Name
aconitase 2, mitochondrial
References
  • Robbins AH, et al. (1989) The structure of aconitase. Proteins. 5 (4): 289-312.
  • Lauble H, et al. (1992) Crystal structures of aconitase with isocitrate and nitroisocitrate bound. Biochemistry. 31 (10): 2735-48.
  • Robbins AH, et al. (1989) Structure of activated aconitase: formation of the 4Fe-4S cluster in the crystal. Proc Natl Acad Sci. 86 (10): 3639-43.
  • Aconitase 2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Rhesus CG90615-G
    Aconitase 2 cDNA ORF Clone, Rhesus, untagged CG90615-UT
    Aconitase 2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90615-ACG
    Aconitase 2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90615-ACGLN
    Aconitase 2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90615-ANG
    Aconitase 2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90615-ACR
    Aconitase 2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90615-ANR
    Aconitase 2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90615-CF
    Aconitase 2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90615-NF
    Aconitase 2 cDNA ORF Clone, Rhesus, C-His tag CG90615-CH
    Aconitase 2 cDNA ORF Clone, Rhesus, N-His tag CG90615-NH
    Aconitase 2 cDNA ORF Clone, Rhesus, C-HA tag CG90615-CY
    Aconitase 2 cDNA ORF Clone, Rhesus, N-HA tag CG90615-NY
    Aconitase 2 cDNA ORF Clone, Rhesus, C-Myc tag CG90615-CM
    Aconitase 2 cDNA ORF Clone, Rhesus, N-Myc tag CG90615-NM

    Aconitase 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Rat RG80908-U
    Aconitase 2 cDNA ORF Clone, Rat, untagged RG80908-UT
    Aconitase 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80908-ACG
    Aconitase 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80908-ACGLN
    Aconitase 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80908-ANG
    Aconitase 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80908-ACR
    Aconitase 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80908-ANR
    Aconitase 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80908-CF
    Aconitase 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80908-NF
    Aconitase 2 cDNA ORF Clone, Rat, N-His tag RG80908-NH
    Aconitase 2 cDNA ORF Clone, Rat, C-HA tag RG80908-CY
    Aconitase 2 cDNA ORF Clone, Rat, N-HA tag RG80908-NY
    Aconitase 2 cDNA ORF Clone, Rat, C-Myc tag RG80908-CM
    Aconitase 2 cDNA ORF Clone, Rat, N-Myc tag RG80908-NM
    Aconitase 2 qPCR Primer Pairs, Rat RP300872

    Aconitase 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Mouse MG51015-G
    Aconitase 2 cDNA ORF Clone, Mouse, untagged MG51015-UT
    Aconitase 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51015-ACG
    Aconitase 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51015-ACGLN
    Aconitase 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51015-ANG
    Aconitase 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51015-ACR
    Aconitase 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51015-ANR
    Aconitase 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51015-CF
    Aconitase 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51015-NF
    Aconitase 2 cDNA ORF Clone, Mouse, C-His tag MG51015-CH
    Aconitase 2 cDNA ORF Clone, Mouse, N-His tag MG51015-NH
    Aconitase 2 cDNA ORF Clone, Mouse, C-HA tag MG51015-CY
    Aconitase 2 cDNA ORF Clone, Mouse, N-HA tag MG51015-NY
    Aconitase 2 cDNA ORF Clone, Mouse, C-Myc tag MG51015-CM
    Aconitase 2 cDNA ORF Clone, Mouse, N-Myc tag MG51015-NM
    Aconitase 2 qPCR Primer Pairs, Mouse MP200974

    Aconitase 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Aconitase 2 cDNA ORF Clone in Cloning Vector, Human HG10958-M
    Aconitase 2 cDNA ORF Clone, Human, untagged HG10958-UT
    Aconitase 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10958-ACGLN
    Aconitase 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10958-ACG
    Aconitase 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10958-ANG
    Aconitase 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10958-ACR
    Aconitase 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10958-ANR
    Aconitase 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10958-CF
    Aconitase 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10958-NF
    Aconitase 2 cDNA ORF Clone, Human, C-His tag HG10958-CH
    Aconitase 2 cDNA ORF Clone, Human, N-His tag HG10958-NH
    Aconitase 2 cDNA ORF Clone, Human, C-HA tag HG10958-CY
    Aconitase 2 cDNA ORF Clone, Human, N-HA tag HG10958-NY
    Aconitase 2 cDNA ORF Clone, Human, C-Myc tag HG10958-CM
    Aconitase 2 cDNA ORF Clone, Human, N-Myc tag HG10958-NM
    Aconitase 2 qPCR Primer Pairs, Human HP100834
    info info
    添加购物车成功! 添加购物车失败!