Быстрый заказ

Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса ABCD4 Информация о продукте «Клон cDNA»
    Размер кДНК:1821bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus ATP-binding cassette, subfamily D (ALD), member 4 with C terminal His tag.
    Синоним гена:Pxmp1l
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    ( We provide with ABCD4 qPCR primers for gene expression analysis, RP301022 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81058-ACGRBS16760
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81058-ACRRBS16760
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81058-CFRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81058-CHRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81058-CMRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81058-CYRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81058-NFRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81058-NHRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81058-NMRBS14710
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81058-NYRBS14710
    Крыса ABCD4 Джин клон кДНК в вектор клонированияRG81058-URBS5130
    Крыса ABCD4 Джин ORF экспрессии кДНК клона плазмидыRG81058-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81058-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.