Быстрый заказ

Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat ABCD1 Информация о продукте «Клон cDNA»
Размер кДНК:2214bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ATP-binding cassette, subfamily D (ALD), member 1 with N terminal Flag tag.
Синоним гена:RGD1562128
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81596-ACGRBS16760
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81596-ACRRBS16760
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81596-ANGRBS16760
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81596-ANRRBS16760
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81596-CFRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81596-CHRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81596-CMRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81596-CYRBS14710
Крыса ABCD1 Джин клон кДНК в вектор клонированияRG81596-GRBS5130
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81596-NFRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81596-NHRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81596-NMRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81596-NYRBS14710
Крыса ABCD1 Джин ORF экспрессии кДНК клона плазмидыRG81596-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.