After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rabbit LOC100355687 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_002710760.1
Размер кДНК:2625bp
Описание кДНК:Full length Clone DNA of Oryctolagus cuniculus zinc finger and homeodomain protein 1-like with C terminal HA tag.
Синоним гена:LOC100355687
Виды:Rabbit
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65141-ACGRBS22240
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65141-ACRRBS22240
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаTG65141-ANGRBS22240
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаTG65141-ANRRBS22240
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65141-CFRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65141-CHRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65141-CMRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65141-CYRBS20190
Кролик ZHX1 Джин клон кДНК в вектор клонированияTG65141-GRBS5130
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65141-NFRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65141-NHRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65141-NMRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65141-NYRBS20190
Кролик ZHX1 Джин ORF экспрессии кДНК клона плазмидыTG65141-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».