Быстрый заказ

Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Кролик IL17A Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_002714498.1
    Размер кДНК:462bp
    Описание кДНК:Full length Clone DNA of Rabbit interleukin 17A-like with N terminal Flag tag.
    Синоним гена:LOC100339322
    Виды:Rabbit
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65006-ACGRBS22240
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65006-ACRRBS22240
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65006-CFRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65006-CHRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65006-CMRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65006-CYRBS20190
    Кролик IL17A Джин клон кДНК в вектор клонированияTG65006-GRBS5130
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65006-NFRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65006-NHRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65006-NMRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65006-NYRBS20190
    Кролик IL17A Джин ORF экспрессии кДНК клона плазмидыTG65006-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Ссылки
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • Size / Price
    Каталог: TG65006-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».