Быстрый заказ

Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Кролик GTF3C2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:XM_002709954.1
    Размер кДНК:2739bp
    Описание кДНК:Full length Clone DNA of Oryctolagus cuniculus general transcription factor IIIC, polypeptide 2, beta 110kDa with C terminal His tag.
    Синоним гена:GTF3C2
    Виды:Rabbit
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65142-ACGRBS22240
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65142-ACRRBS22240
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаTG65142-ANGRBS22240
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаTG65142-ANRRBS22240
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65142-CFRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65142-CHRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65142-CMRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65142-CYRBS20190
    Кролик GTF3C2 Джин клон кДНК в вектор клонированияTG65142-GRBS5130
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65142-NFRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65142-NHRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65142-NMRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65142-NYRBS20190
    Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмидыTG65142-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: TG65142-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».