After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rabbit GTF3C2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_002709954.1
Размер кДНК:2739bp
Описание кДНК:Full length Clone DNA of Oryctolagus cuniculus general transcription factor IIIC, polypeptide 2, beta 110kDa with C terminal His tag.
Синоним гена:GTF3C2
Виды:Rabbit
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65142-ACGRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65142-ACRRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаTG65142-ANGRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаTG65142-ANRRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65142-CFRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65142-CHRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65142-CMRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65142-CYRBS20190
Кролик GTF3C2 Джин клон кДНК в вектор клонированияTG65142-GRBS5130
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65142-NFRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65142-NHRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65142-NMRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65142-NYRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмидыTG65142-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: TG65142-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».