Быстрый заказ

Text Size:AAA

Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rabbit GTF3C2 Информация о продукте «Клон cDNA»
Размер кДНК:2739bp
Описание кДНК:Full length Clone DNA of Oryctolagus cuniculus general transcription factor IIIC, polypeptide 2, beta 110kDa with C terminal HA tag.
Синоним гена:GTF3C2
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаTG65142-ACGRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаTG65142-ACRRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаTG65142-ANGRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаTG65142-ANRRBS22240
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаTG65142-CFRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаTG65142-CHRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаTG65142-CMRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаTG65142-CYRBS20190
Кролик GTF3C2 Джин клон кДНК в вектор клонированияTG65142-GRBS5130
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаTG65142-NFRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаTG65142-NHRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаTG65142-NMRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаTG65142-NYRBS20190
Кролик GTF3C2 Джин ORF экспрессии кДНК клона плазмидыTG65142-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: TG65142-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.