DYNLL1 cDNA ORF Clone, Rabbit, N-HA tag

Cat: TG65052-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All DYNLL1 Reagents

CRO Services

Product recommended


All DYNLL1 Reagents

DYNLL1 cDNA ORF Clone, Rabbit, N-HA tag General Information

Gene

Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Rabbit dynein, light chain, LC8-type 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DYNLL1 Background Information

Full Name
dynein, light chain, LC8-type 1

DYNLL1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
DYNLL1 cDNA ORF Clone in Cloning Vector, Rabbit TG65052-G
DYNLL1 cDNA ORF Clone, Rabbit, untagged TG65052-UT
DYNLL1 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65052-ACGLN
DYNLL1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65052-ACG
DYNLL1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65052-ANG
DYNLL1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65052-ACR
DYNLL1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65052-ANR
DYNLL1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65052-CF
DYNLL1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65052-NF
DYNLL1 cDNA ORF Clone, Rabbit, C-His tag TG65052-CH
DYNLL1 cDNA ORF Clone, Rabbit, N-His tag TG65052-NH
DYNLL1 cDNA ORF Clone, Rabbit, C-HA tag TG65052-CY
DYNLL1 cDNA ORF Clone, Rabbit, C-Myc tag TG65052-CM
DYNLL1 cDNA ORF Clone, Rabbit, N-Myc tag TG65052-NM

DYNLL1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DYNLL1 cDNA ORF Clone in Cloning Vector, Rat RG82999-U
DYNLL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82999-ACGLN

DYNLL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DYNLL1 cDNA ORF Clone in Cloning Vector, Mouse MG51246-U
DYNLL1 cDNA ORF Clone, Mouse, untagged MG51246-UT
DYNLL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51246-ACG
DYNLL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51246-ACGLN
DYNLL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51246-ANG
DYNLL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51246-ACR
DYNLL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51246-ANR
DYNLL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51246-CF
DYNLL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51246-NF
DYNLL1 cDNA ORF Clone, Mouse, C-His tag MG51246-CH
DYNLL1 cDNA ORF Clone, Mouse, N-His tag MG51246-NH
DYNLL1 cDNA ORF Clone, Mouse, C-HA tag MG51246-CY
DYNLL1 cDNA ORF Clone, Mouse, N-HA tag MG51246-NY
DYNLL1 cDNA ORF Clone, Mouse, C-Myc tag MG51246-CM
DYNLL1 cDNA ORF Clone, Mouse, N-Myc tag MG51246-NM
DYNLL1 qPCR Primer Pairs, Mouse MP201129

DYNLL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DYNLL1 cDNA ORF Clone, Human, untagged HG18017-UT
info info
添加购物车成功! 添加购物车失败!